English site

CDS : AM1_4919

CDS Description

CDSAM1_4919
Product namefmn-dependent NADH-azoreductase, putative
Gene name
ContigCP000828
location4965479..4966117
NBRC No.102967
MicrobeAcaryochloris marina
Current status
>AM1_4919 fmn-dependent NADH-azoreductase, putative
MLSPDSKPRCLLHMDVSARVQGSYSRQLTQKFVSQWQQANPHHQIIYRDIGRFPIPHIDE
TWVAAYESEPEERTAEMQAAIALSDTLIDELFAADCYVMGIPMYNLTVPSTFKAYLDQVF
RRDRTLQIVNGIPQGQLANKKLLVITTRKYNYRVGSGREDRDFLEPYLSAIFKVIGLTDI
SYIHADQLASALEREHSLAKATQMIHQLALNF


>AM1_4919 fmn-dependent NADH-azoreductase, putative
ATGCTTTCTCCAGACTCCAAGCCCCGTTGCTTACTCCACATGGATGTGAGTGCCCGCGTC
CAAGGCTCTTACTCCCGCCAGCTTACCCAAAAATTTGTCTCTCAATGGCAACAGGCCAAC
CCCCATCACCAGATCATTTATCGCGATATTGGCCGTTTCCCCATCCCCCATATTGATGAG
ACTTGGGTTGCAGCTTATGAATCTGAACCGGAGGAACGTACAGCTGAGATGCAGGCTGCG
ATCGCACTCTCCGATACCCTGATCGATGAGCTGTTCGCCGCCGACTGCTATGTGATGGGG
ATACCCATGTACAACCTAACGGTGCCGTCTACGTTTAAAGCGTATCTAGATCAGGTATTT
AGACGCGATCGCACCTTGCAAATCGTCAATGGCATCCCCCAAGGACAACTAGCGAACAAA
AAACTTTTAGTGATTACTACCCGAAAATATAATTACCGAGTGGGGTCAGGACGAGAAGAT
CGAGATTTTCTAGAACCATATCTCAGTGCCATTTTTAAGGTTATAGGGCTGACTGATATT
TCATATATTCATGCTGACCAATTAGCATCAGCCCTTGAACGAGAGCACTCTCTGGCTAAG
GCAACCCAAATGATTCATCAACTAGCTTTGAACTTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)