English site

CDS : BLi01002

CDS Description

CDSBLi01002
Product nameputative NADPH-dependent FMN reductase YhdA
Gene nameyhdA
ContigAE017333
location1005347..1005865
NBRC No.12195
MicrobeBacillus licheniformis
Current status
>BLi01002 putative NADPH-dependent FMN reductase YhdA
MKITVISGTARKQGRTRIAASYIARAYQAELIDLSEFILPIFNGDEEQSSLENVQKLKAS
VKEADAVVLLSPEYHSGMSGALKNALDFLSNEQFSGKPVALFACAGGGKGGMNALANMRI
VARGVYANVITKQLVLDPIHIDEEHQTVTEAAKANIKNVMEELLLFAEFQKA


>BLi01002 putative NADPH-dependent FMN reductase YhdA
ATGAAAATAACCGTAATTAGCGGAACTGCGAGAAAACAGGGCAGAACGCGGATCGCCGCT
TCCTATATCGCCCGCGCTTATCAGGCTGAGCTTATCGATCTAAGCGAGTTCATCCTTCCG
ATTTTCAACGGAGACGAAGAGCAAAGCTCGCTGGAGAATGTTCAAAAATTGAAAGCTTCG
GTCAAAGAAGCAGACGCTGTCGTTTTATTATCTCCCGAATACCACAGCGGTATGAGCGGC
GCTTTGAAAAATGCACTCGATTTTTTAAGCAATGAGCAGTTCTCGGGCAAACCGGTGGCG
CTTTTTGCTTGTGCAGGGGGCGGCAAAGGCGGGATGAACGCGCTCGCCAATATGCGCATT
GTCGCACGCGGAGTTTATGCGAACGTCATCACAAAGCAGCTTGTGCTCGATCCGATTCAT
ATTGATGAGGAGCACCAAACGGTTACTGAAGCAGCCAAAGCCAATATTAAAAATGTAATG
GAAGAGCTTCTGCTCTTTGCCGAATTTCAAAAAGCCTGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)