English site

CDS : BLi02245

CDS Description

CDSBLi02245
Product nameFMN-dependent NADH-azoreductase AzoR
Gene nameazoR1
ContigAE017333
location2202556..2203182
NBRC No.12195
MicrobeBacillus licheniformis
Current status
>BLi02245 FMN-dependent NADH-azoreductase AzoR
MSKVLFVKANDRTAEEAVSVKLYEAFLNSYKENHPNDEIVELDLYRENPPYLGRNAINGT
FKAGKGMELNEDEKAAAAVADRYLDEFVKADKVVFAFPLWNFAVPAVLHTYVDYLSRAGV
TFTYTPEGPKGLMGDKKVALLNARGGFYSEGPMAAMEMSLNYMKTVMGFFGVQDLHTVVI
EGHNAVPDDAQKIIENGLAEAKKLAASF


>BLi02245 FMN-dependent NADH-azoreductase AzoR
ATGTCTAAAGTATTGTTTGTTAAAGCTAATGACCGTACAGCTGAAGAAGCTGTATCTGTA
AAACTTTATGAAGCGTTTCTTAACAGCTATAAAGAAAATCATCCAAACGATGAAATTGTA
GAGCTTGACCTTTACAGAGAAAACCCGCCGTACCTAGGCAGAAATGCCATTAACGGGACA
TTTAAAGCAGGAAAAGGCATGGAATTGAACGAGGATGAAAAAGCTGCCGCCGCTGTAGCG
GATCGTTACTTAGACGAATTCGTCAAAGCCGATAAGGTTGTTTTTGCTTTCCCATTGTGG
AACTTCGCCGTTCCAGCTGTACTTCACACTTATGTGGACTACTTGTCCCGCGCAGGAGTG
ACGTTTACATACACTCCTGAAGGACCTAAAGGCCTGATGGGAGATAAGAAGGTTGCTCTG
TTAAATGCAAGAGGAGGCTTCTATTCTGAAGGACCGATGGCTGCAATGGAAATGTCGTTG
AACTACATGAAAACCGTCATGGGCTTCTTCGGTGTTCAAGACTTGCATACCGTTGTCATC
GAAGGACACAACGCTGTTCCTGACGACGCTCAAAAAATTATTGAAAACGGCTTAGCAGAA
GCTAAAAAGCTTGCAGCATCATTTTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)