English site

CDS : BLi03573

CDS Description

CDSBLi03573
Product nameFMN-dependent NADH-azoreductase AzoR
Gene nameazoR2
ContigAE017333
location3417332..3417967
NBRC No.12195
MicrobeBacillus licheniformis
Current status
>BLi03573 FMN-dependent NADH-azoreductase AzoR
MTKTLYITAHPHDERASYSMAAGKAFIESYKEAHPDDEVIHLDLYRENIPQIDADVFSGW
GKLQSGSGFEQLSEHEKAKVGRLNELSEQFIAGDKYVFVTPLWNFSFPPVMKAYFDAVAV
AGKTFKYTEQGPIGLLTDKKALHIQARGGYYSEGQAAELEMGHRYISIMMQFFGVPEFEG
LFIEGHNAEPDKAEEIKQNAIVRAKELGRTF


>BLi03573 FMN-dependent NADH-azoreductase AzoR
ATGACAAAAACCCTTTACATTACCGCTCACCCGCATGACGAAAGGGCATCCTACAGCATG
GCGGCAGGAAAAGCGTTTATCGAATCTTACAAAGAAGCTCATCCGGATGACGAAGTCATA
CACCTTGATCTTTATCGGGAAAACATTCCGCAGATTGATGCGGATGTTTTCAGCGGCTGG
GGAAAATTGCAGTCGGGGTCGGGCTTTGAACAGCTTTCTGAACACGAAAAAGCTAAAGTC
GGCCGTTTGAATGAGCTGAGCGAGCAATTTATCGCGGGAGACAAATACGTGTTTGTCACG
CCGCTTTGGAATTTCTCTTTTCCGCCGGTGATGAAAGCGTACTTCGATGCGGTCGCTGTA
GCGGGAAAGACGTTTAAATATACCGAACAGGGACCGATCGGGCTGTTAACCGATAAAAAA
GCGCTGCACATCCAGGCGAGAGGCGGCTACTATTCAGAAGGGCAGGCTGCGGAACTTGAG
ATGGGGCACCGCTATATCAGCATCATGATGCAGTTTTTCGGGGTTCCGGAATTTGAAGGT
TTATTTATAGAAGGGCATAATGCTGAGCCTGATAAAGCTGAAGAAATAAAACAAAATGCG
ATTGTCCGAGCCAAAGAATTGGGCAGGACTTTTTGA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)