English site

CDS : BSU6633_05219

CDS Description

CDSBSU6633_05219
Product nameazoreductase
Gene name
ContigADGS01000009
location31742..32368
NBRC No.3134
MicrobeBacillus subtilis
Current status
>BSU6633_05219 azoreductase
MSTVLFVKSSDRTAEEGVSTKLYEAFLAAYKENNPADEVVELDLHKENLPYLGRDMINGT
FKAGQGMEMTEEEKKQAAIADKYLNQFVKADKVVFAFPLWNFTVPAVLHTYVDYLSRAGV
TFKYTQEGPVGLMGDKKVALLNARGGIYSEGPMAALEMSLNFMKTVLGFWGVQDLHTVVI
EGHNAAPDQAQEIVEKGLQEAKDLAAKF


>BSU6633_05219 azoreductase
ATGTCTACAGTATTATTTGTAAAATCAAGCGACCGTACAGCCGAAGAAGGCGTTTCAACT
AAACTTTACGAGGCTTTCTTAGCTGCTTATAAAGAAAATAACCCTGCTGATGAAGTGGTT
GAATTAGATCTTCATAAAGAGAACCTTCCTTACCTTGGAAGAGATATGATTAACGGAACA
TTTAAAGCAGGTCAAGGAATGGAAATGACAGAAGAAGAGAAAAAACAAGCTGCAATTGCC
GACAAATATCTGAACCAGTTTGTAAAAGCTGACAAAGTTGTTTTCGCATTCCCGCTTTGG
AACTTCACAGTGCCGGCAGTTCTTCATACTTATGTTGATTACCTGTCTCGTGCAGGCGTT
ACATTCAAATACACACAAGAAGGACCAGTTGGTTTAATGGGAGACAAAAAAGTTGCACTC
CTTAACGCGCGCGGCGGCATTTACTCTGAAGGACCAATGGCTGCACTTGAAATGTCATTA
AACTTCATGAAAACAGTTCTTGGTTTCTGGGGTGTTCAAGACTTGCACACAGTTGTTATC
GAAGGACATAACGCAGCGCCTGATCAAGCTCAAGAAATCGTTGAAAAAGGTTTACAAGAA
GCAAAAGATCTAGCTGCAAAATTCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)