English site

CDS : BSU6633_14662

CDS Description

CDSBSU6633_14662
Product nameoxidoreductase, NAD(P)H-FMN and ferric iron reductase
Gene name
ContigADGS01000027
location58303..58827
NBRC No.3134
MicrobeBacillus subtilis
Current status
>BSU6633_14662 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
MNMLVINGTPRKHGRTRIAASYISALYHTDLIDLSEFILPIFNGEAEQSELLQVQELKQR
VTKADAIVLISPEYHSGMSGALKNALDYLSSEQFKYKPVALLAVAGGGKGGINALNNMRT
VMRGVYANVIPKQLVLDPVHIDIENAAVTENIKVSIKELVEELSMFAKAGNPGV


>BSU6633_14662 oxidoreductase, NAD(P)H-FMN and ferric iron reductase
ATGAACATGTTAGTCATAAACGGTACGCCTAGAAAACATGGCAGAACGAGAATTGCCGCA
TCCTATATTTCAGCGTTGTATCACACGGATTTAATTGACCTAAGTGAGTTTATATTGCCG
ATTTTTAACGGTGAAGCGGAGCAATCTGAACTTTTGCAGGTACAGGAGCTTAAGCAGCGC
GTCACTAAAGCGGATGCAATTGTCTTAATATCTCCTGAATATCACAGCGGCATGAGCGGC
GCTTTAAAAAATGCGCTGGATTATCTAAGCAGCGAACAATTTAAATATAAGCCCGTGGCA
TTATTGGCAGTGGCGGGAGGCGGAAAAGGCGGCATCAACGCGCTGAACAATATGAGAACG
GTGATGCGGGGTGTCTACGCCAATGTCATTCCGAAGCAGCTCGTGCTTGATCCGGTGCAC
ATTGATATTGAAAATGCTGCAGTGACGGAAAATATAAAGGTCAGCATAAAAGAGCTTGTC
GAAGAACTCAGCATGTTTGCAAAAGCAGGAAATCCCGGCGTCTGA


Assigned Rule

Assigned RuleRelated Function
AZR (NRULE_0237)NADPH azoreductaseAromatic azo compounds degradation (NFUNC_0073)