English site

CDS : EAE_20445

CDS Description

CDSEAE_20445
Product nameazoreductase
Gene name
ContigCP002824
location4382124..4382729
NBRC No.13534
MicrobeEnterobacter aerogenes
Current status
>EAE_20445 azoreductase
MSKVLVLKSSILAGYSQSGQLSDYFVEQWREKHAGDVITVRDLAANPIPVLDGELVGALR
PSDAQLTARQQEALALSDELIAELKANDVIVIAAPMYNFNIPTQLKNYFDLVARAGVTFR
YTEKGPEGLVTGKRAVVLTSRGGIHKDTPTDLVTPYLTTFLGFIGITDVNFVFAEGIAYG
PEVAAKAQSDAKAAIDSVVAA


>EAE_20445 azoreductase
ATGAGCAAAGTATTAGTTCTGAAGTCCAGTATTCTTGCAGGGTACTCGCAATCCGGCCAG
CTGTCCGACTATTTTGTTGAACAATGGCGTGAAAAACACGCAGGCGACGTTATCACCGTG
CGCGATCTGGCGGCAAACCCGATTCCGGTACTGGATGGTGAACTGGTTGGCGCGCTGCGT
CCGAGTGATGCACAGTTGACCGCACGTCAACAGGAAGCGCTGGCACTGTCCGATGAACTG
ATCGCTGAACTGAAAGCTAACGATGTGATTGTTATCGCCGCGCCGATGTATAACTTCAAC
ATCCCGACTCAGCTGAAAAACTATTTCGACCTGGTTGCCCGTGCAGGCGTCACCTTCCGT
TACACCGAGAAAGGTCCGGAAGGCCTGGTCACCGGTAAACGTGCGGTAGTACTGACCAGC
CGCGGTGGTATTCATAAAGATACGCCGACCGATCTGGTTACGCCGTATCTGACCACCTTC
CTTGGCTTTATCGGCATCACCGACGTGAATTTCGTATTTGCTGAAGGTATTGCTTATGGT
CCAGAAGTTGCGGCCAAAGCGCAGTCCGATGCCAAAGCGGCTATCGACAGCGTAGTTGCA
GCCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)