English site

CDS : PROVALCAL_02954

CDS Description

CDSPROVALCAL_02954
Product nameNAD(P)H dehydrogenase (quinone)
Gene name
ContigABXW01000053
location143966..144565
NBRC No.105687
MicrobeProvidencia alcalifaciens
Current status
>PROVALCAL_02954 NAD(P)H dehydrogenase (quinone)
MSKVLLLKSSILADYSHSNKMADYFVQQWKEKNPTDEFLVRDLVKQPIPAIDGEILAAFA
PTDTKTAQQQALLDLSNQLIDEIKQSDVLVITAPMYNFSVPSQLKHYFDFIARSGHTFKY
TEQGSVGLLNNKRAYVLTSRGGIYKDTPTDIMVPYITLFLNFIGITDIEFIFAEGTALGA
ESVENAHSQAREHMNTLIA


>PROVALCAL_02954 NAD(P)H dehydrogenase (quinone)
ATGAGTAAAGTATTACTATTGAAATCCAGCATTCTGGCGGATTACTCACACAGCAACAAA
ATGGCCGATTATTTTGTACAACAGTGGAAAGAAAAAAATCCTACTGATGAATTTCTCGTT
AGAGATTTAGTTAAGCAGCCTATCCCTGCCATTGATGGCGAAATTTTAGCAGCTTTTGCG
CCAACTGACACTAAAACAGCACAGCAACAAGCACTTTTAGACCTATCAAATCAACTGATT
GATGAGATTAAGCAAAGTGATGTTTTAGTGATCACGGCACCTATGTACAATTTTTCAGTG
CCTTCTCAACTGAAGCACTATTTTGATTTTATCGCGCGCTCAGGGCATACCTTTAAATAT
ACCGAGCAAGGTTCTGTCGGTTTATTAAATAATAAACGTGCATATGTACTAACAAGTCGT
GGCGGAATTTATAAAGATACACCAACGGATATTATGGTGCCTTATATCACGTTATTCTTG
AATTTTATTGGCATTACAGATATTGAATTTATTTTTGCAGAAGGTACTGCACTCGGTGCT
GAATCAGTTGAGAATGCTCATTCTCAGGCCAGAGAACATATGAATACATTGATTGCCTAA


Assigned Rule

Assigned RuleRelated Function
AZOR (NRULE_0236)FMN-dependent NADH-azoreductaseAromatic azo compounds degradation (NFUNC_0073)